The mixture was incubated at 37°C water bath for 3 hrs. Subsequently, 75 μl of 10% SDS and 125 μl of 5 M NaCl were added to cell pellet and incubated at 37°C for 30 min. Reaction tubes were later incubated at −40°C for 5 min

and subsequently to 65°C water bath for 3 min. This step was repeated 3 times and the supernatant was collected by centrifugation at 8,000 rpm for 10 min at room temperature. Selleck Capmatinib To the supernatant, 50 μg/ml Proteinase K and 200 μg/ml RNase were added and incubated at 37°C for 30 min. Equal volume of phenol: chloroform: isoamyl alcohol (25:24:1) was added to the solution and mixed by inversion. After centrifugation at 8,000 rpm for 5 min, upper aqueous phase containing DNA was recovered and precipitated with two volumes of 95% ethanol by centrifugation at 13,000 rpm for 15 min. DNA pellet was dissolved in 50 μl of TE buffer and stored at −40°C for further use. PCR amplification of 16S rRNA www.selleckchem.com/products/geneticin-g418-sulfate.html Amplification of 16S rRNA was performed using universal primers 16Sf (5′ AGAGTTTGATCCTGGCTCAG 3′) and 16Sr (5′ GGTTACCTTGTTACGACTT 3′). Final volume of reaction was 25 μl, which comprised Taq buffer (1×), dNTP’s (200 μM) (MBI Fermentas, USA), forward and reverse primer (0.5 μM), MgCl2 (1.0 mM), Taq DNA polymerase (1.25 U; MBI Fermentas),

template (1 μl) and remaining autoclaved Milli Q water. PCR was performed with the initial denaturation at 98°C for 3 min, followed by 30 cycles of reaction with denaturation at 94°C for 1 min; annealing at 53°C for 1 min; extension at 72°C and final extension at 72°C for 10 min. PCR PI3K inhibitor amplified products were Pregnenolone analyzed on 1.5% agarose gel along with DNA molecular weight marker (MBI Fermentas). Positive amplicons as judged by size were purified using QIAquick PCR purification kit (Qiagen, Germany) and sequenced on an ABI PRISM 377 genetic analyzer (Applied Biosystems, USA). Phylogenic analysis

16S rRNA sequences of the potential strains (Streptomyces sp. NIOT-VKKMA02, Streptomyces sp. NIOT-VKKMA26 and Saccharopolyspora sp. NIOT-VKKMA22) was aligned manually in GenBank database with BLAST [33] and the sequences with 100-98% homology were considered for molecular taxonomy analysis. Multiple alignment of 16S rRNA sequences in this study and sequences in GenBank database was performed with CLUSTAL X program [34]. Phylogenetic trees were constructed by neighbor-joining and maximum-parsimony tree making methods in Molecular Evolutionary Genetic Analysis (MEGA version 5.0) [35] and bootstrap values based on 1,000 replication [36]. Results Physico-chemical parameters The details of sampling site and various physico-chemical properties of water samples collected from the site are provided in Table 1. In sampling site, DO value was observed to be 6.24 mg/l in both surface and bottom waters.