Tidal volume (VT) was 7 mL/kg and respiratory frequency (f) was twelve breaths per minute. A five-centimeter H2O PEEP was maintained and 10,000 U of Heparin i.v. (Sanofi-Aventis, Ploërmel, France) was administered. The pigs were killed using pentobarbital i.v. (Chemische Fabrik, Berg, Germany) (25 mg/kg) and potassium chloride i.v. (5 g). Pneumoplegia was performed by infusing 1 L of the preservation fluid

Perfadex® (Vitrolife AB, Gothenburg, Sweden) at 4°C in the right ventricule. Perfadex® was buffered with Trometamol (Addex-THAM, Kabi, Sweden). Finally, the lungs were extracted and stored in a cold room at 4°C for 30 minutes. The usefulness of EVLP selleck screening library is well known and described in literature [7, 12, 17, 43]. Many parameters of our ex vivo preparation was performed in a “state of the art” EVLP setting and published by research teams that are experts in the field [36]. In our experiments, our purpose was not to demonstrate or suggest an evolution of the EVLP technique, but rather to use such experimental preparations to evaluate the benefit of the CsA to reduce IRI. The ex Obeticholic Acid datasheet vivo lung function assessment system was primed with 2.8 L of Perfadex® added with 5% of bovine serum albumin (Sigma-Aldrich, St. Louis, MO, USA), and 2 mg/L of Trinitrine (Sanofi-Aventis). The pulmonary artery was cannulated with a 20-F cannula (Turemo,

Ann Arbor, MI, USA) connected to the extracorporeal circuit. A pressure probe (Baxter, Uden, Holland) was first placed into the pulmonary artery, then a temperature probe (Sorin Group, Arvada, CO, USA) was connected to the membrane oxygenator; finally, a second temperature probe (Integral Process, Conflans Sainte Honorine, France) was placed at the pulmonary vein exit. During the rewarming

phase, 2 L/min of oxygen and 2 L/min of nitrogen (93%) mixed with carbon dioxide (7%) were carried to the membrane oxygenator. Isotonic trometamol was used to obtain a physiologic pH in the mixed solution. The rewarming of the lung preparations was initiated by a slow infusion (100 mL/min) at 25°C. The peristaltic pump flow was gradually increased along with the temperature of the perfusion fluid. At 32°C, ventilation was started (VT = 50 mL, f = 12/min, Lepirudin PEEP = 5 cmH2O, FiO2 = 50%) and then gradually increased by increments of 20 mL up to a maximal VT of 7 mL/kg. During this rewarming phase, the pump flow was progressively increased up to 1.3 L/min (normal cardiac output for a 20 kg pig). However, PAP was never allowed to exceed 25 mmHg. The pump flow was fixed with a lower pressure less than 25 mmHg in order to preserve the integrity of the capillary-alveolar membrane. The rewarming phase was considered complete when the temperature of the solution from the pulmonary veins reached 36°C, while full cardiac output and ventilation were also obtained.

This is the first clonal genetic analysis of human monoclonal CD4-reactive Ab. A mAb against CD4 isolated from a healthy individual could be useful in the intervention of HIV/AIDS. CD4 is a T-cell marker that serves as a principal receptor for HIV. CD4-reactive Ab are detected in HIV-infected

individuals (∼13%) 1, 2 and HIV-exposed seronegative individuals (34%) 3. In addition, some healthy individuals are positive for anti-CD4 Ab (∼0.6%) 4. Replication of multiple HIV clades is blocked by mouse mAb against CD4 in vitro and in vivo5–12. Thus, it is possible that anti-CD4 Ab play a role in protecting individuals Venetoclax supplier from HIV infection and delaying AIDS disease progression. Similar arguments have been made for Ab against CCR5, a coreceptor for HIV 3, 10, 13. Furthermore,

some clinical studies suggest that CD4-reactive Ab, including a humanized mAb, has therapeutic potential against HIV infection and AIDS progression 5, 8, 10, 12. However, the development and pathophysiological roles of self-recognizing Ab in healthy individuals are still largely unknown, and a human mAb against CD4 has not yet been isolated. To gain insights into the genesis of auto-reactive Ab and to characterize the nature of CD4-reactive auto-Ab, we conducted experiments to isolate human monoclonal anti-CD4 Ab from PBMC of 12 HIV-seronegative adult donors. We succeeded in isolating three independent IgM clones recognizing CD4 from a healthy donor. Analysis of the V-region sequences of CD4-reactive Ab revealed a preference for V gene Dabrafenib mw usage to give rise to CD4-reactive Ab. This is the first report describing CD4-reactive human mAb. PBMC were collected from 12 HIV-seronegative adult volunteers, including two healthy and ten with autoimmune disorders, and B-lymphoblastoid cell lines (B-LCL) were established by infecting the cells with EBV (for experimental procedure, see Supporting Information Fig. 1). B-LCL were propagated in oligoclonal

pools. In 790 cultures selleck chemicals llc from one healthy donor, we identified two cultures positive for recombinant human CD4 (rhCD4) reactivity, HO538 and HO702, using ELISA (Fig. 1A). This donor may have a unique Ab repertoire, as auto-reactive B-LCL cultures were identified significantly more frequently in this donor than in the others (Fig. 1A). The rhCD4 reactivity was specific, as no binding was observed to 72 other viral, bacterial, and auto-Ag screened in parallel (Supporting Information Fig. 2). We amplified the Ig genes encoding the Fab regions by RT-PCR and cloned them into the bacterial expression vector pFabI-His2 that produces Fab fragments of an inserted set of VH and VL genes. We expected that some clones should reconstitute the CD4-reactive Fab present in the original B-LCL cultures. After screening by ELISA, one CD4-reactive Fab clone, HO538-213, was isolated from the HO538 culture, and two independent clones, HO702-001 and HO702-016, were isolated from the HO702 culture.

We investigated selleck the association between CKD as well as type 2 diabetes and the risk of cancer incidence among ethnic Chinese in a Taiwanese community. Methods: A total of 3602 adults more than 35 years old (average 54.9 ± 12.3 yrs, 52.8% women) were recruited. CKD was defined as an estimated glomerular filtration rate <60 mL/min/1.73 m2 and diabetes as fasting glucose > = 126 mg/dl or on hypoglycemic medication.

Cox proportional hazard regression models were applied to examine association for the overall and site-specific risks of cancer. Cancers were ascertained through regular follow-up interviews and official documents. Results: During a median of 10.5 years’ follow-up, 275 individuals developed cancers, including 157 digestive cancers and 31 urinary trait cancers). Compared with those without CKD, participants with CKD had a 1.83 (95% confidence interval [CI], 1.31–2.58) fold risk of overall cancer. Younger participants (<55 yrs) with diabetes were more likely to have a greater risk for overall cancers (adjusted relative risk [RR], 3.42, 95% CI, 1.78–6.57), the digestive cancers (adjusted RR, 2.88, 95%CI, 1.15–6.94) and the urinary trait cancers(adjusted RR, 13.4, 95%CI, 2.70–66.3).

Conclusion: We clearly demonstrated that middle-age LDE225 research buy ethnic Chinese individuals Exoribonuclease with CKD and diabetes had a greater risk for overall and specific-type cancers. INDRA TITIES, ANGGRAENI1, LYDIA AIDA1, PURNAMASARI DYAH2, SETIATI SITI3 1Division of Renal Disease and Hypertension, Departement of Internal Medicine, Faculty of Medicine University of Indonesia/Dr.Cipto Mangunkusumo hospital, Jakarta; 2Division of Endocrine and Metabolic, Departement of Internal Medicine, Faculty of Medicine University of Indonesia/Dr.Cipto Mangunkusumo hospital,Jakarta University of Indonesia;

3Division of Geriatrics, Departement of Internal Medicine, Faculty of Medicine University of Indonesia/Dr.Cipto Mangunkusumo hospital,Jakarta University of Indonesia Introduction: In line with the increasing number of patients with diabetes mellitus type 2 in Indonesia, the incidence of diabetic nephropathy is also increased. Various factors aggravating diabetic nephropathy have been identified, among others vitamin D 25(OH)D level. Vitamin D has a non-calcemic effect on renin-angiotensin system, causing albuminuria. The aim of this study was to know the association between vitamin D 25(OH)D level with albuminuria in patients with type 2 diabetes mellitus in Indonesia. Methods: A cross-sectional study was conducted in 96 patients with type 2 diabetes mellitus at outpatient clinic of Metabolic-Endocrine Dr.Cipto Mangunkusumo Hospital Jakarta.

M199, RPMI, HBSS, FBS, endothelial cell growth supplement (ECGS) and Matrigel were from Invitrogen (Burlington, Ont., Canada). ND and FITC-phalloidin were from Sigma (St. Louis, MO, USA). Stromal cell derived factor-1α (SDF-1α, CXCL12) and Phycoerythrin-conjugated CD144 were from R&D Systems (Minneapolis, MN, USA). TNF-α was from Invitrogen Biosource (Carlsbad, CA, USA). To isolate CD3+ lymphocytes, StemSep negative selection system from StemCell Technologies (Vancouver, BC, Canada) was used. Mouse anti-β-tubulin was from Biomeda (Foster City, CA, USA) and rabbit anti-VE-cadherin was from Cayman (Cedarlane

Laboratories, Mississauga, Ont., Canada). Rabbit IQGAP1 antibody was from Santa Cruz FDA-approved Drug Library price Biotechnology (Santa Cruz, CA,USA). Monoclonal PECAM-1 antibody was from Endogen, Woburn, MA, USA. Monoclonal CD99 was from MyBiosource (San Diego, CA, USA). Monoclonal Jam-1 was from GenTex (Irvine, CA, USA). Fluorophore-conjugated

antibodies were from Jackson Immunoresearch (West Grove, PA, USA). All secondary antibodies were tested for nonspecific binding. CellTrackers were from Molecular Probes (Eugene, OR, USA). Hiperfect, non-silencing siRNA, IQGAP1 siRNA (sequence: AAGGAGACGTCAGAACGTGGC) and APC siRNA (sequence: CCGGTGATTGACAGTGTTTCA) were from Qiagen (Mississauga, Ont., Canada). HUVEC and PBL were isolated and cultured as described previously 45. HUVEC were grown on 35 mm dishes coated with 1 mg/mL Matrigel 72 h prior to TEM experiments, and treated with 10 ng/mL TNF-α 20–24 h before assembly of the parallel plate flow chamber apparatus. Where indicated, HUVEC were loaded with 10 μmol/L ND or equivalent JQ1 chemical structure DMSO dilution for 3 min and washed extensively before the experiments. Where indicated, the EC monolayer was treated with ND as above, and conditioned binding buffer was collected after 10 min. Lymphocytes were resuspended in this conditioned medium and used for TEM assay. To inhibit IQGAP1 or APC expression, HUVEC were transfected twice on consecutive days with either 10 nmol/L non-silencing or 10 nmol/L validated IQGAP1 or APC siRNA using Hiperfect Palmatine according to the

manufacturer’s direction. IQGAP1 and APC expression was optimally inhibited 96 and 72 h after first transfection, respectively. IQGAP1 or APC inhibition was tested by Western blotting as described previously 46. Lymphocyte TEM was studied by parallel-plate laminar flow adhesion assay as described previously 45. Briefly, Lymphocytes were perfused over the EC monolayer at low shear flow (0.5 dyne/cm2) and allowed to accumulate on the EC. The flow rate was then increased to 1 dyne/cm2 throughout the assay (10 or 20 min). The adherent lymphocytes were scored for surface motility (including both lymphocytes that migrate more than one cell body on the surface of the EC monolayer and those that transmigrate) or transmigrating lymphocytes (cells that undergo a change from phase-bright to phase-dark appearance).

Whether vascular calcification can be prevented or reversed with strategies PF-02341066 purchase aimed at maintaining phosphate homeostasis is as yet unknown. One recent study also determined an association between serum phosphate within the normal range and vascular and valvular calcification.21 This study of 439 young and middle-age participants from the Multi-Ethnic Study of Atherosclerosis (MESA) with both normal renal function and CKD, and no known CVD, reported that after adjustment for eGFR, each 1 mg/dL increase in serum phosphate concentration was significantly associated with a 21%, 33%,

25% and 62% greater prevalence of coronary artery, thoracic, aortic valve and mitral valve calcification respectively. The CARDIA study, described earlier, also showed that phosphate levels within the reference range were significantly associated with coronary artery calcium levels in a young healthy adult population.19 Elevations in serum phosphate have been associated with structural changes and renal decline in animal models.68 In human observational studies, hyperphosphataemia is associated with progression of established CKD and the development of ESKD (end-stage RO4929097 kidney

disease)23,69–71 and studies of renal transplant recipients describe an association between higher serum phosphate and renal allograft loss.27,28 Serum phosphate levels in the upper-normal range have also recently been reported to be associated with an increased risk of developing incident CKD and ESKD.6,24 One study involving 2269 participants from the Framingham Heart Study showed that those in the highest phosphate category had an increased risk of CKD with OR 2.14 (95% CI 1.07–4.28) ZD1839 ic50 when compared with the reference group with serum phosphate 2.5–3.49 mg/dL.6 The same study also analysed 13 372 participants

from the Third National Health and Nutrition Examination Survey (NHANES III) and reported that phosphate ≥4 mg/dL was associated with an increased risk of incident ESKD (RR 1.90 (95% CI 1.03–3.53)). Zoccali et al. recently evaluated the relationship between baseline serum phosphate, disease progression and response to angiotensin-converting enzyme (ACE) inhibition in 331 patients with proteinuric CKD in the prospective Ramipril Efficacy In Nephropathy (REIN) trial.72 Phosphate levels in the highest two quartiles were significantly associated with faster progression to both ESKD and to a composite end-point of doubling of serum creatinine or ESKD compared with patients with phosphate levels below the median. Therefore, with higher serum phosphate levels the renoprotective effect of ramipril decreased, despite adjustment for potential confounders such as GFR and urinary protein. This suggests that phosphate may potentially modify the protective effect of the only real therapeutic class of agents used in CKD. FGF-23 is the most potent hormone regulating phosphate homeostasis.73 In health, FGF-23 is secreted by osteocytes and osteoblasts in response to dietary phosphate intake.

Cells expressing CXCR3 colocalized with its find more chemokine ligand CXCL9 [monokine induced by interferon gamma, MIG] in the vaginal lamina propria. Conclusion  These results indicate that the frequency of SIV-specific CD8+ T cells in the female genital mucosa is enriched compared with peripheral blood and provide initial information regarding the signals that direct recruitment of T cells to the female reproductive tract. Sexual transmission of HIV infection to women occurs predominantly across cervicovaginal mucosal surfaces. Primate studies have shown that simian immunodeficiency

virus (SIV) enters the epithelium of the vaginal mucosa and infects intraepithelial dendritic cells within 60 min of exposure to cell-free virus, with virus-infected cells appearing in local lymph nodes within 18 hrs.1 Virus-specific immune responses in genital mucosa are therefore likely to be critical for initial control of vaginal infection with HIV or SIV. The presence of HIV- and SIV-specific T cells in the genital mucosa of women and female rhesus macaques has been reported by several groups. Kaul et al.2 demonstrated that HIV-specific CD8+ cytokine responses were lower in lymphocytes isolated from the cervix than in peripheral blood of HIV-infected women, whereas in exposed uninfected subjects, these responses were higher in cervix

than in blood. Virus-specific cytotoxic T-cell activity has also been shown following in vitro stimulation of T cells isolated from cervical specimens from Selleck C646 HIV-infected women3 and SIV-infected macaques.4 High frequencies of SIV-specific CD8+ T-cell responses were reported in cervicovaginal tissues in SIV-infected macaques5 and in macaques vaccinated with the live attenuated SHIV 89.6 vaccine.6 While these studies establish the presence of functional cellular immune responses in the female Suplatast tosilate genital mucosa, they have provided only limited information regarding molecules mediating trafficking of virus-specific cells to genital mucosa. The events that control trafficking of virus-specific lymphocytes

into tissue compartments, and particularly genital mucosa, are incompletely understood. Molecules known to participate in this process include chemokines and their receptors, which have been shown to regulate lymphocyte traffic in normal and inflammed tissues.7 Chemokines produced in inflammation induce the migration of lymphocytes expressing CXCR3, CCR5, and other receptors for inflammatory chemokines into the inflamed tissues. This differential expression of chemokines by tissues has been implicated in the control of cytotoxic T lymphocyte (CTL) trafficking to sites of viral replication.8 In this study of SIV-infected female rhesus macaques, the frequency of CD8+ T cells specific for the immunodominant Mamu-A*01-restricted SIV Gag181–189 epitope9 was determined in blood, mucosal tissues, and secondary lymphoid organs by flow cytometry using peptide/MHC class I tetramers.

Age-related modifications included decreased pitch standard deviation and increased number of syllables in speech to NH-AM infants and increased number of syllables in speech to HI and NH-EM infants across the 12-month period. These results suggest that mothers are sensitive to the hearing status of their infants and modify characteristics of infant-directed speech

over time. “
“Adult observers are sensitive to statistical regularities present in natural images. Developmentally, research has shown that children do not show sensitivity to these natural regularities until approximately 8–10 years of age. This finding is surprising given that even infants gradually encode a range of high-level statistical regularities Obeticholic Acid molecular weight of their

visual environment in the first year of life, We suggest that infants may in fact exhibit sensitivity to natural image statistics under circumstances where images of complex, natural textures, such as a photograph of rocks, are used as experimental stimuli and natural appearance is substantially manipulated. We tested this hypothesis by examining how infants’ visual preference for real versus computer-generated synthetic textures was modulated by contrast Caspase inhibitor clinical trial negation, which produces an image similar to a photographic negative. We observed that older infants’ (9-months of age) preferential looking behavior in this task was affected by contrast polarity, suggesting that the infant visual system is sensitive to

deviations from natural texture appearance, including (1) discrepancies in appearance that differentiate natural and synthetic textures from one another and (2) the disruption of contrast polarity following negation. We discuss our results in the context of adult texture processing and the “perceptual narrowing” of visual recognition during the most first year of life. “
“Although it is well accepted that parents greatly impact infant development, it is less clear which factors impact change in quantity and quality of parenting across infancy. This longitudinal study (N = 120 families) investigated how infant temperament and marital adjustment related to trajectories of mother and father involvement and sensitivity across infancy using multilevel models. Parental involvement (caregiving and play), infant temperament (surgency, negative affectivity, regulation), and marital adjustment were assessed from questionnaires when the infant was 3, 5, 7, 12, 14, and 20 months of age; parental sensitivity was coded from two episodes of the Still-Face Paradigm in early infancy (3, 5, and 7 months). On average, mothers showed higher levels of caregiving, play, and sensitivity than fathers. Mother caregiving, play, and sensitivity increased over time. Father caregiving and play also increased over time, whereas sensitivity did not change with age. Happier marriages were related to increased play for both mothers and fathers.

At times, MRI was performed in combination with [18F]fluorodeoxyglucose (FDG) positron emission tomography (PET) scans to assess glucose metabolism [17,21,48], [11C]SCH 23 390 for D1 receptor binding and [123I]iodobenzamide

(IBZM) or [11C]raclopride (RAC) for D2 receptor binding [17,19–21], allowing for the evaluation of the extent of grafted cell survival and functionality. For example, Hauser et al. reported that putaminal glucose metabolism and D1 receptor binding did not decrease as usually expected with disease progression, VX-770 nmr although this was not observed in the caudate nucleus. The authors suggested that this was likely due to the small amount of tissue implanted [17]. However, they also reported a decrease in D2 receptor binding in the putamen and caudate nucleus, presumably due to the selective survival of transplanted neurones or to differences in the time-course or capacity for expression of these receptors [17]. Gaura et al. reported that at 30 months after transplantation,

brain glucose metabolism was either increased or stable in all parts of the striatum when compared with images obtained immediately after surgery. Small regions corresponding to the grafts, as identified by MRI, showed a higher metabolic activity compared with the host striatum. Cortical and striatal hypometabolism was ameliorated in three patients 3-MA nmr 2 years after transplantation, which correlated with functional improvement [49]. However, at the 6-year post-transplantation follow-up, glucose metabolism had decreased again [50]. Two patients in whom no increase in metabolic activity had been detected at 2 years [48] continued to deteriorate clinically and, accordingly, MRI did not indicate improvements at 6 years after surgery [50]. Reuter et al. reported Succinyl-CoA increased D2 receptor binding at 6 months in one transplanted patient, which slightly

declined afterwards but stayed at levels higher than baseline, whereas another patient did not exhibit any improvement on imaging [20]. Imaging techniques have also been of crucial importance in identifying potential complications and irregularities, although graft complication or unusual grafting patterns remain anecdotal. One single case, which had taken part in a phase II trial conducted by the Institut National de la Santé et de la Recherche Médicale (INSERM), was diagnosed with encephalitis and displayed striatal glucose hypometabolism, which were interpreted by the authors as signs of graft rejection. These were identified at 14 months after grafting when the patient had become ill after being taken off a 9-month regime of immunosuppressive drugs [51].

[32] In the postnatal period in the pig, NOS activity is greatest in the pre-glomerular

resistance vasculature of the newborn kidney immediately after birth, but decreases as maturation progresses.[33] Furthermore, the different isoforms of NOS differentially regulate renal vasodilatation during the neonatal period compared with the adult. Expression of the neuronal isoform of NOS (nNOS) in the renal resistance vasculature is greatest in the newborn pig, but expression of endothelial NOS (eNOS) is greatest in the adult.[32] In Z-IETD-FMK mw alignment with this, nNOS predominantly contributes to renal blood flow in the postnatal period but CDK inhibition eNOS contributes to renal blood flow in the adult.[32]

Importantly, expression of nNOS has been shown to be greatest in the macula densa of the developing kidney of the pig,[32] a site important in modulating TGF activity. An increase in NO production has been shown to decrease the sensitivity of TGF.[34] Thus, it can be inferred that NO produced by nNOS facilitates the decrease in afferent arteriolar resistance in the postnatal period by decreasing the sensitivity of TGF. Although nNOS appears to be important in the resetting of TGF, it is not necessary in the long term since nNOS knockout mice have a normal TGF response.[29] This is supported by the fact that nNOS expression declines but expression of eNOS increases during the postnatal period.[32] Presumably this increase in eNOS expression compensates for the decline in expression of nNOS and in the long term, eNOS maintains basal renal haemodynamics. Nevertheless, it appears that the high expression

of nNOS at birth[32] is necessary to reset the sensitivity of TGF and promote afferent vascular dilatation. Normal postnatal maturation of the kidney is characterized by oxyclozanide both functional and structural adaptations of the glomerulus and tubules. The following sections of this review will focus firstly on both the structural and functional adaptations to nephron loss. We will then put forward a hypothesis regarding mechanisms via which compensatory renal growth may be implicated in the onset of hypertension and chronic kidney disease. Compensatory renal growth also occurs following surgical reduction in renal mass (uninephrectomy or sub-total nephrectomy) and is associated with significant hypertrophy of the tubules and the glomeruli. In the rat kidney, the increase in length of proximal tubules can be as much as 70–90%[10, 35, 36] with a more modest (17–40%) increase in length occurring in the distal tubules.

brasiliensis-infected Smarta/4get mice. The lack of Th2 cells in infected DO11/4get/Rag−/− or Smarta/4get mice does not formally exclude the possibility

that N. brasiliensis causes bystander activation of Th2 cells in a setting where antigen-specific T cells are present. To address this point we transferred CD4 T cells from DO11/4get/Rag−/− mice into normal 4get mice which were subsequently infected with N. brasiliensis. The transferred T cells did not differentiate into Th2 cells whereas T cells of the recipient mouse showed a normal Th2 response in lung and mesenteric lymph click here nodes (Fig. 5). The transferred T cells were not functionally compromised because infection with a mixture of N. brasiliensis and OVA resulted in efficient Th2 cell differentiation of the donor T cells while OVA administration alone did not induce Th2 polarization (Fig. 5). Taken together, these results demonstrate that bystander differentiation of naive T cells into Th2 cells does not occur even in the presence of a strong type 2 immune response and therefore we conclude that essentially all Th2 cells in N. brasiliensis-infected mice are parasite-specific

T cells. We could previously demonstrate that infection of mice selleckchem with N. brasiliensis leads to accumulation of eosinophils and basophils in the lung28 and that this response could not be observed in Rag-deficient or MHC class II-deficient mice,29 suggesting that CD4 T cells are responsible for this effect. Furthermore, using an adoptive transfer system, we could previously show that IL-4/IL-13 from CD4 T cells was required for the IgE response whereas worm expulsion required IL-4/IL-13

from innate cells.29 To determine whether a reduced TCR repertoire would affect the efficiency of effector cell mobilization, IgE production and worm expulsion, we compared these three parameters in N. brasiliensis-infected 4get, DO11/4get and DO11/4get/Rag−/− mice. Eosinophils and basophils clonidine accumulated with comparable efficiency in spleen and lung of 4get and DO11/4get mice but no increase could be observed in DO11/4get/Rag−/− mice (Fig. 6a). Total serum IgE levels were strongly increased in both 4get and DO11/4get mice, which demonstrates that mice with a reduced TCR repertoire are still able to induce a profound polyclonal IgE response (Fig. 6b). Antigen-specific IgG1 response was detectable but significantly reduced in DO11/4get compared with 4get mice (Fig. 6c). Finally, worm expulsion was impaired in DO11/4get mice when compared with 4get mice, indicating that efficient immunity against this parasite requires a broad repertoire of TCR specificities (Fig. 6d). To further prove that a polyclonal T-cell population is required for protective immunity, we reconstituted Smarta/4get mice with 107 polyclonal naive CD4 T cells from 4get mice. The N.