GAS and its isogenic mutant were grown in Todd-Hewitt broth (THB

GAS and its isogenic mutant were grown in Todd-Hewitt broth (THB (Difco, Detroit, MI)) at 37°C without shaking. For in vitro and in vivo experiments, fresh overnight cultures were diluted 1:10 in THB and grown to

mid logarithmic phase (OD600 = 0.4) and resuspended in PBS, or in mid-log supernatants for neutrophil assays with NZ131. For analysis of streptococcal supernatants, strains were grown in C-medium (0.5% (w/v) Proteose Peptone no. 2 (Difco), 1.5% (w/v) yeast extract, 10 mM K2HPO4, 0.4 mM MgSO4, 17 mM NaCl pH 7.5) to maximize EndoS expression. GAS mutants click here EndoS is encoded by the gene ndoS. A precise, in-frame allelic replacement of ndoS with chloramphenicol transferase, cat, was created in M1T1 GAS strain 5448 by a method previously described [13] and was denoted 5448ΔndoS. Briefly, a 798 bp fragment upstream, and 987 bp fragment downstream

of ndoS was amplified using polymerase chain reaction, PCR, using primers ndoS-up-F-XbaI (GCATCTAGAGCTTGTCGGTCTTGGGGTAGC), ndoS-up-R (GGTGGTATATCCAGTGATTTTTTTCTCCATTTGGACACTCCTTATTTTTGGTACTAAGT C) and ndoS-dn-F (TACTGCGATGAGTGGCAGGGCGGGGCGTAAACAAAGTAACTTTCTTAGATAGCAACATT Selleckchem LY333531 CAG), ndoS-dn-R-BamHI (GCGGATCCGTTCTTGCGCCATGACACCTCC) respectively. The primers adjacent to ndoS contained 30 bp overhang of the cat gene corresponding to the 5′ and 3′ ends of cat, respectively. either The upstream and downstream fragments were combined with the

650 bp cat gene in a fusion PCR using primers ndoS-up-F-XbaI and ndoS-dn-R-BamHI. This triple fragment was digested using restriction enzymes XbaI and BamHI and ligated using T4 ligase into the temperature sensitive vector pHY304, bearing erythromycin resistance, to generate the knockout plasmid pHY-ndoS-KO. pHY-ndoS-KO was transformed into GAS 5448 by electroporation and transformants were grown at the permissive temperature of 30°C with erythromycin. Transformants were then grown at the non-permissive temperature of 37°C with erythromycin present to select for homologous recombination and integration of the plasmid into the genome. Single crossovers were confirmed by PCR analysis. Relaxation of the plasmid was carried out at 30°C with no antibiotic selection to allow the plasmid to reform, outside the chromosome. Growing the bacteria at 37°C without antibiotic pressure resulted in loss of the plasmid. Finally, screening for erythromycin sensitive colonies was used to identify double crossover events and allelic replacement mutants were confirmed by PCR. In frame allelic replacement ndoS mutant, 5448ΔndoS, was confirmed by multiple PCR reactions showing the insertion of the cat gene and absence of the ndoS gene in the genome. Heterologous buy Quizartinib expression of EndoS in M49 GAS strain NZ131 was established by transformation with the EndoS expression plasmid pNdoS.

Comments are closed.