The strains were previously developed this website shikimate kinase-deficient E. coli KPM SA1 (∆aroK, ∆aroK) (Ahn et al., 2008) and its derivative that was constructed by the disruption of the pgi gene following an established protocol. Briefly, a PCR product was generated from plasmid pKD13 (Datsenko & Wanner, 2000) using two primers (5′-cgctacaatcttccaaagtcacaattctcaaaatcagaagagtattgctagtgta-ggctggagctgcttc-3′ and 5′-gttgccgg atgcggcgtgaacgccttatccggcctacatatcgacgatgaattccggggatccgtcgacc-3′). The PCR products contained a kanamycin resistance marker (kan) flanked by short regions of homology to the pgi gene at

the 5′- and 3′-ends (underlined in primer sequences). Escherichia coli KPM SA1 (∆aroK, ∆aroK) harboring pKD46 (Datsenko & Wanner, 2000) was grown in SOB medium (2% (w/v) bacto tryptone, 0.5% (w/v) yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, pH 7) containing 50 mg L−1 ampicillin and 1 mM l-arabinose and

the cells were transformed with the PCR products using an electroporator (Bio-Rad, Hercules, CA). Kanamycin-resistant APO866 datasheet strains were selected on agar plates and PCR reactions were carried out to test for correct chromosomal structures with kan-specific and locus-specific primers. The subsequent deletion of the kan gene from E. coli KPM SA1 (∆aroK, ∆aroK, ∆pgi::kan) was made using a curable helper plasmid encoding the FLP recombinase (pCP20) (Datsenko & Wanner, 2000). The resultant E. coli KPM SA1 (∆aroK, ∆aroK, ∆pgi) was confirmed by PCR reaction. The pgi− mutant and pgi+ strains were transformed with plasmid pKPM-SA1 containing tyrosine-insensitive aroFFBR and wild-type aroE controlled by the PR-PL promoter and RVX-208 temperature-sensitive CI857 repressor from bacteriophase λ and kan, respectively. Culture media were prepared as previously described (Ahn et al., 2008). Glucose, fructose,

and glucose/fructose mixture were used as carbon sources. The temperature was controlled at 38 °C while pH was maintained at 7.0 by the addition of 24% (v/v) ammonia water. The dissolved oxygen concentration was kept above 20% of air saturation by increasing the agitation speed to 1000 r.p.m. Cell growth was monitored by measuring the OD600 nm using an UVICON 930 apparatus (UVICON, Basel, Switzerland). The dry cell weight was estimated by a predetermined conversion factor of 0.34 g dry cell weight/L/OD600 nm. Concentrations of the carbon source and SA were measured using high-performance liquid chromatography (Gilson, Middleton, WI) with an HPX 87H column using refractive index and ultraviolet detectors (set at 210 nm). The most recent genome-scale metabolic model of E. coli, named iAF1260 (Feist et al., 2007), was used to elucidate cellular metabolism under the various experimental conditions. The iAF1260 model was modified to allow for SA secretion by rendering the existing periplasmic SA transport reaction reversible. To mimic the genetic condition of the E.